《【病毒外文文獻】2014 EF1A interacting with nucleocapsid protein of transmissible gastroenteritis coronavirus and plays a role in virus r》由會員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻】2014 EF1A interacting with nucleocapsid protein of transmissible gastroenteritis coronavirus and plays a role in virus r（29頁珍藏版）》請在裝配圖網(wǎng)上搜索。

Accepted Manuscript Title EF1A interacting with nucleocapsid protein of Transmissible Gastroenteritis Coronavirus and plays a role in virus replication Author Xin Zhang Hongyan Shi Jianfei Chen Da Shi Changlong Li Li Feng PII S0378 1135 14 00280 6 DOI http dx doi org doi 10 1016 j vetmic 2014 05 034 Reference VETMIC 6640 To appear in VETMIC Received date 25 4 2014 Revised date 29 5 2014 Accepted date 30 5 2014 Please cite this article as Zhang X Shi H Chen J Shi D Li C Feng L EF1A interacting with nucleocapsid protein of Transmissible Gastroenteritis Coronavirus and plays a role in virus replication Veterinary Microbiology 2014 http dx doi org 10 1016 j vetmic 2014 05 034 This is a PDF file of an unedited manuscript that has been accepted for publication As a service to our customers we are providing this early version of the manuscript The manuscript will undergo copyediting typesetting and review of the resulting proof before it is published in its final form Please note that during the production process errors may be discovered which could affect the content and all legal disclaimers that apply to the journal pertain Page 1 of 28 Accepted Manuscript EF1A interacting with nucleocapsid protein of Transmissible Gastroenteritis Coronavirus 1 and plays a role in virus replication 2 3 Xin Zhang 1 Hongyan Shi 1 Jianfei Chen 1 Da Shi 1 Changlong Li 1 Li Feng 1 4 1 Division of Swine Infectious Diseases National Key Laboratory of Veterinary 5 Biotechnology Harbin Veterinary Research Institute of the Chinese Academy of 6 Agricultural Sciences Harbin 150001 China 7 8 To whom correspondence should be addressed 9 Division of Swine Infectious Diseases National Key Laboratory of Veterinary 10 Biotechnology Harbin Veterinary Research Institute of the Chinese Academy of 11 Agricultural Sciences No 427 Maduan Street Nangang District Harbin 150001 China 12 E mail fl 13 Tel 86 18946066048 14 Fax 86 451 51997164 15 Page 2 of 28 Accepted Manuscript 2 ABSTRACT 16 Transmissible gastroenteritis coronavirus TGEV is an enteropathogenic coronavirus 17 that causes diarrhea in pigs which is correlated with high morbidity and mortality in 18 suckling piglets Using the method of GST pull down with the nucleocapsid N N 19 protein was found to interact with swine testes ST cells elongation factor 1 alpha 20 EF1A an essential component of the translational machinery with an important role in 21 cells In vitro and in virus infected cells interaction was then confirmed by 22 co precipitation Knockdown of EF1A impairs N protein proliferation and TGEV 23 replication in host cell In was demonstrated that EF1A plays a role in TGEV replication 24 The present study thus provides a protein related information that should be useful for 25 underlying mechanism of coronavirus replication 26 Page 3 of 28 Accepted Manuscript 3 Introduction 27 Coronaviruses CoVs includes four genera alpha beta gamma and 28 deltacoronavirus which have been clustered in the Coronavirinae subfamily de Groot et 29 al 2011 Reguera et al 2012 Coronaviruses CoVs are pleomorphic enveloped 30 viruses Perlman and Netland 2009 Transmissible gastroenteritis virus TGEV is a 31 representative CoV in the alphacoronavirus genus severe acute respiratory 32 syndrome related coronavirus SARS related CoV is a representative of the 33 betacoronavirus genus infectious bronchitis virus IBV is a representative of the 34 gammacoronavirus genus and Bulbul CoV is a representative of the deltacoronavirus 35 genus de Groot et al 2011 TGEV is positive RNA viruses which is a large family of 36 enveloped virus Masters 2006 The infection of TGEV causes severe diarrhea in 37 suckling piglets about 2 weeks old which results in enormous economic loss in 38 swine producing areas in the world Kim and Chae 2001 Sestak et al 1996 TGEV 39 genome 28 5 kb encodes the replicase gene rep at the 5 end and encodes other viral 40 genes at the 3 end 5 S 3a 3b E M N 7 3 Penzes et al 2001 TGEV genome encodes 41 four structural proteins spike S membrane M minor envelope E and nucleocapsid 42 N 43 CoVs N proteins are highly basic with a molecular mass ranging from 40 to 63 kDa 44 depending on the species and strains N protein binds to the RNA genome forming a 45 helical nucleocapsid Escors et al 2001 Sturman et al 1980 N protein has a structural 46 Page 4 of 28 Accepted Manuscript 4 role in coronavirus assembly Risco et al 1996 and is a growing evidence for a role in 47 RNA synthesis Almazan et al 2004 Baric et al 1988 Stohlman et al 1988 Some 48 reports have been studied the response of host cell to TGEV Ding et al 2012 Wei et al 49 2012 Howerer there is few report about the interaction of N protein with host cell 50 Elongation factor 1 alpha EF1 is a major translation factor involved in protein 51 synthesis in mammalian cells EF1 is an abundant G protein that delivers 52 aminoacyl tRNA to the elongating ribosome Carvalho et al 1984b EF1 hydrolyzes 53 GTP dissociates from the aminoacyl tRNA and leaves the ribosome Moldave 1985 54 Except a major translation factor EF1 plays important multifunctional roles in 55 mammalian cells EF1 Interacts with newly synthesized polypeptides for quality 56 surveillance Hotokezaka et al 2002 In ubiquitin dependent degradation EF1 57 interacted with ubiquitinated proteins and is essential for ubiquitin dependent degradation 58 Chuang et al 2005 Gonen et al 1994 EF1 undergoes several post translational 59 modifications mainly phosphorylation and methylation and plays important role in 60 facilitating apoptosis Lamberti et al 2004 61 Recently some reports showed that EF1A interacted with viral proteins The 62 interaction between EF1A and N protein of SARS CoV was founded Zhou et al 2008 63 There is no report about whether EF1A interacted with N protein of TGEV In this study 64 we demonstrate that EF1 associates with N protein of TGEV and plays a role in virus 65 replication This study will provide protein related information for underlying mechanism 66 of coronavirus replication 67 Page 5 of 28 Accepted Manuscript 5 Materials and methods 68 Cells and virus 69 Swine testes ST cells were obtained from ATCC ST cells were grown in RPMI 1640 70 medium supplemented with 10 fetal calf serum under standard culture conditions 5 71 CO 2 37 C TGEV infectious strain H Accession No FJ755618 and TGEV attenuated 72 strain H Accession No EU074218 were propagated on an ST cell monolayer Wang et 73 al 2010 Pathogenicity of the TGEV infectious strain H is stronger than TGEV 74 attenuated strain H However the attenuated TGEV virus was better to adapt ST cells 75 than infectious TGEV 76 Antibodies 77 Mouse monoclonal antibody mAb to glyceraldehyde 3 phosphate dehydrogenase 78 GAPDH ab9484 and Rabbit polyclonal antibody pAb to EF1A ab140632 were 79 purchased from Abcam FITC labeled goat anti mouse IgG was purchased from 80 Kirkegaard and Perry Laboratories KPL TRITC labeled goat anti rabbit IgG was 81 purchased from Sigma mAb to N protein of TGEV was prepared in our lab 82 Cell infection 83 ST cells were infected with TGEV infectious strain H or TGEV attenuated strain H at a 84 multiplicity of infection MOI of 1 After adsorption for 1 h cells were washed and 85 incubated in fresh RPMI 1640 until required post inoculation hpi 86 Page 6 of 28 Accepted Manuscript 6 Construction of recombinant expression plasmid 87 N gene of TGEV was amplified with primers F TGEV N 5 88 CAGGATCCGCCAACCAGGGACAACGT 3 and R TGEV N 89 5 CACTCGAGGTTCGTTACCTCATCAATCA 3 containing Bam HI and Xho I 90 enzyme sites PCR products were subcloned into a prokaryotic expression pGEX 6p 1 91 vector GE Healthcare Recombinant expression plasmid was designated as 92 pGEX TGEV N and confirmed by DNA sequencing 93 GST pull down assay 94 GST N protein was expressed was expressed in Escherichia coli BL21 DE3 under 95 induction of 1 mM isopropyl D thiogalactopyranoside GST N fusion protein was 96 immobilized on beads at 4 C for 2 h The lysate of ST cells was prepared using 1 ml 97 RIPA lysis buffer 50 mM Tris HCl pH 7 4 150 mM NaCl 1 mM EDTA and 1 98 Triton X 100 containing a protease inhibitor phenylmethanesulfonyl fluoride PMSF 1 99 mM After centrifugation at 12 000 g for 15 min cell lysate 500 g was incubated 100 with the GST N protein preparation at 4 C overnight After washing four times with 101 buffer 50 mM Tris pH 7 5 150 mM NaCl 0 05 NP 40 the isolated pull down 102 proteins were then analyzed by 12 PAGE analysis Expressed GST protein was used as 103 a control 104 Co immunoprecipitation Co IP assay 105 The lysate of ST cells infected with TGEV for 24 h was prepared with RIPA lysis 106 Page 7 of 28 Accepted Manuscript 7 buffer 50 mM Tris HCl pH 7 4 150 mM NaCl 1 NP 40 0 25 deoxycholate 107 containing a protease inhibitor phenylmethanesulfonyl fluoride PMSF 1 mM After 108 centrifugation at 12 000 g for 15 min lysate supernatant was pretreated with protein A G 109 plus agarose Beyotime for 30 min at 4 C to eliminate non specific binding to the 110 agarose beads The lysate supernatant 500 g was incubated with 1 g of rabbit pAb to 111 EF1 for overnight at 4 C Then 20 l resuspended Protein A G PLUS Agarose was 112 added to this mixture and incubated at 4 C on a rocker platform for 2 h After washing 113 four times with lysis buffer the isolated immunoprecipitated proteins were then analyzed 114 by western blotting using mAb to N protein of TGEV and rabbit pAb to EF1A The lysate 115 of TGEV mock infected ST cells was used as a control 116 Western blotting 117 Equivalent amounts of cell lysates were subjected to 12 PAGE and then transferred 118 to 0 22 m nitrocellulose membranes Hybond C Extra Amersham Biosciences After 119 blotting the membranes were incubated with rabbit pAb to EF1A for 1 h After washing 120 three times with PBST the membranes were inoculated with HRP conjugated goat 121 anti rabbit IgG Sigma at 37 C for 1 h and visualized using 122 3 3 5 5 tetramethylbenzidine stabilized substrate TMB Amresco 123 Immunofluorescence assay 124 ST cells inoculated with TGEV were cultured for 24 h The cells were washed twice 125 with PBS and fixed with paraformaldehyde 4 for 30 min at 4 C and then allowed to 126 Page 8 of 28 Accepted Manuscript 8 air dry After blotting with 5 skimmed milk powder the fixed cells were incubated with 127 mAb to TGEV N protein 1 100 and rabbit pAb to EF1A 1 50 for 1 h at 37 C in a 128 humidified chamber After washing three times with PBST the fixed cells were incubated 129 with FITC labeled goat anti mouse IgG 1 100 KPL and TRITC labeled goat anti rabbit 130 IgG 1 200 Sigma The additional nuclear staining with 4 6 diamidino 2 phenylindole 131 DAPI Sigma was performed as described previously Jungmann et al 2001 The 132 triple stained cells were washed three times with PBST and subsequently examined under 133 a Leica TCS SP5 laser confocal microscopy 134 Transfection of siRNA against EF1A 135 siRNA against EF1A GenePharma was used for transfection The sequence of the 136 siRNA strands was as follows 5 GUGGUAUUACCAUUGACAUTT 3 sense and 137 5 AUGUCAAUGGUAAUAACCACTT 3 antisense Transfection with siRNA was 138 performed with X tremeGENE siRNA reagent Roche by following the manufacturer s 139 instructions ST cells were cultured overnight in six well tissue culture plates The siRNA 140 20 nM was complexed with X tremeGENE siRNA reagent by incubating together at 141 room temperature for 30 min After removing the cell culture supernatant the complex 142 was added for incubation 36 h 143 Virus titer assay 144 Page 9 of 28 Accepted Manuscript 9 ST cells were re plated 1 day before infection in 96 well plates for the 50 infectious 145 dose TCID 50 assays Treated samples and their paired controls were thawed as 146 described and immediately serially diluted Cell cultures were then infected for 1 h After 147 48 h of incubation CPE was observed TCID 50 is calculated using the method of Reed 148 and Munch Virus titer assay were performed three times for each condition and were 149 performed using the Student s t test 150 Results 151 Expression and purification of TGEV N protein 152 Full length TGEV N protein with a GST tag was expressed in E coli BL21 DE3 153 using a T7 polymerase expression system GST N protein was successfully expressed and 154 purified in BL21 DE3 in soluble fractions Fig 1 Western blot analysis for detection 155 of the GST tag confirmed expression of an 70 kDa recombinant GST N protein Fig 1 156 Purified full length recombinant GST N protein was used in subsequent experiments 157 EF1A interacting with N protein in vitro 158 The expressed GST N protein immobilized on GST agarose beads was used as a bait to 159 pull down cellular proteins of ST cells that form a complex with N protein GST protein 160 was used as control to eliminate non specifically binding proteins Cellular proteins 161 immobilized on GST agarose beads in GST pull down assay were examined with specific 162 antibodies to EF1A Fig 2 From the GST pull down results we can see that the EF1A 163 Page 10 of 28 Accepted Manuscript 10 protein was found in GST N protein immobilized beads but not in GST protein 164 immobilized beads 165 Cellular EF1A interacts with N protein of TGEV in virus infected cells 166 The immunoprecipitation assay was utilized to elucidate further whether TGEV N protein 167 interacted with cellular EF1A in TGEV infected ST cells From the immunoprecipitation 168 results Fig 3 we can see that the N protein of TGEV was precipitated by the antibody 169 to cellular EF1A in TGEV infected ST cells but not in mock infected ST cells 170 Furthermore the same results were obtained with TGEV infectious strain or with TGEV 171 attenuated strain Fig 3 These results demonstrated that the cellular EF1A interacted 172 with the N protein of TGEV 173 Co localization of EF1A with N protein in TGEV infected cells 174 The subcellular localization of EF1A was investigated in TGEV infected ST cells using 175 indirect immunofluorescence confocal microscopy The results indicated that the 176 subcellular localization of EF1A was distributed in the cytoplasm after TGEV infection 177 Fig 4 Furthermore the red fluorescence of the TRITC labeled goat anti rabbit IgG 178 binding with cellular EF1A was covered with the green fluorescence of the FITC labeled 179 goat anti mouse IgG binding with N protein of TGEV The evidence indicated that 180 cellular EF1A was co localized with N protein of TGEV within the ST cells during 181 infection 182 Page 11 of 28 Accepted Manuscript 11 Knockdown of EF1A impairs TGEV replication in host cell 183 To further investigate the role of EF1A in TGEV virus replication EF1A protein of ST 184 cells was inhibited using siRNA TGEV attenuated virus was used for siRNA analysis 185 The transfected cells expressed lower protein levels of EF1A when compared with the 186 control siRNA transfected cells Fig 5A and 5B ST cells were infected with TGEV for 187 another 8 h or 24 h after transfection with siRNA at an MOI of 1 The viral RNA was 188 measured by quantative real time RT PCR and the N protein of TGEV was measured by 189 western blotting TGEV infection was greatly reduced in the EF1A knockdown cells as 190 shown by a reduction in viral N protein expression Fig 5A and 5B To demonstrate the 191 involvement of EF1A on TGEV replication we quantified the amounts of cell associated 192 virus and virus releasing in culture supernatant at 8 h and 24 h after inoculation Virus 193 titer assay were performed three times for each condition and were performed using the 194 Student s t test At 8 h inoculation the specific numerical TCID 50 of supernatant virus in 195 control siRNA group was 10 3 1 mL and the EF1A siRNA group was 10 2 3 mL The 196 specific numerical TCID 50 of cell associated virus in control siRNA group was 10 3 9 mL 197 and the EF1A siRNA group was 10 3 2 mL At 24 h inoculation the specific numerical 198 TCID 50 of supernatant virus in control siRNA group was 10 4 6 mL and the EF1A siRNA 199 group was 10 3 7 mL The specific numerical TCID 50 of cell associated virus in control 200 siRNA group was 10 4 5 mL and the EF1A siRNA group was 10 3 6 mL Fig 5C shows that 201 knock down of EF1A resulted in significant reduction of cell associated virus which 202 reflected viral replication 203 Page 12 of 28 Accepted Manuscript 12 Discussion 204 N protein of CoVs facilitates template switching and is required for efficient 205 transcription Schelle et al 2005 Thiel et al 2003 Zuniga et al 2010 In addition N 206 protein displays pleiotropic effect when expressed in host cells such as induction of 207 apoptosis or cell cycle arrest He et al 2003 Surjit et al 2004 Some of the functional 208 outcomes that result from N gene expression in host cells are due to direct or indirect 209 interaction between N protein and cellular proteins Studying the interaction of cellular 210 protein with N protein will provide new information for understanding the mechanism of 211 TGEV infection 212 Results from previous study demonstrate that EF1A can anchor mRNA suggesting that 213 EF1A is involved in sorting and regulating the expression of specific cellular mRNAs 214 Bassell et al 1994 EF1 complex is composed of four different subunits alpha beta 215 gamma and delta 2 1 1 1 in mammalian cells Carvalho et al 1984a In TGEV 216 infected cells EF1 may interact with N protein of TGEV that bind to TGEV RNA in a 217 similar manner Instead of an enzymatic activity EF1 may provide protein RNA and 218 protein protein interactions that promote the assembly of TGEV replication complexes 219 In this study the results demonstrate that EF1A can interact with N protein of TGEV It is 220 possible that EF1A is involved in targeting TGEV N onto intracellular membranes that 221 provide a microenvironment for the efficient replication of the viral RNA From the Fig 3 222 we can see that the attenuated strain of TGEV N protein appears to be pulled down much 223 more with EF1A than the wild type N protein in The reason maybe that attenuated TGEV 224 Page 13 of 28 Accepted Manuscript 13 virus was better to adapt ST cells than infectious TGEV data not shown We assumed 225 that the interaction of EF1A and N protein maybe play a role in cell culture adaptation 226 The intrinsic characteristics of EF1A make it a suitable host protein for RNA virus 227 replication Results in this study support a role for EF1A in the replication of CoVs In 228 host cells EF1A is found in high concentrations approximately 1 of the total protein in 229 animal cells Condeelis 1995 and 5 in plant cells Browning et al 1990 For viral 230 replication the abundance of EF1A would make it unnecessary to compete with cellular 231 processes CoVs replicate in many hosts Enjuanes et al 2006 It is likely that host 232 factors selected for virus replication would be both structurally and functionally 233 conserved across different species EF1A affords an excellent model system for the 234 further analysis of host protein and virus interactions 235 EF1 play an important role in some virus infection Several viral proteins have been 236 observed to bind to EF1 The NS5A protein of bovine viral diarrhea virus BVDV 237 interacts with EF1 which may play a role in the replication of BVDV Johnson et al 238 2001 The nucleocapsid protein of SARS CoV interacted with EF1A and inhibited cell 239 proliferation Zhou et al 2008 The RNA dependent RNA polymerase of Turnip mosaic 240 virus TuMv interacts with EF1 in virus induced vesicles Thivierge et al 2008 RNA 241 polymerase of vesicular stomatitis virus VSV specifically associates with EF1 Das et 242 al 1998 Gag polyprotein of Human immunodeficiency virus type 1 HIV 1 interacts 243 with EF1 requires tRNA and EF1 may contribute to tRNA incorporation into HIV 1 244 virions Cimarelli and Luban 1999 Studying the mechanism of EF1A and N protein of 245 Page 14 of 28 Accepted Manuscript 14 TGEV will help to understand the pathogenesis of CoVs 246 Conclusions 247 In summary EF1A interaction with N protein of TGEV was fo