JOURNAL OF VIROLOGY Dec 2011 p 13363 13372 Vol 85 No 24 0022 538X 11 12 00 doi 10 1128 JVI 05300 11 Copyright 2011 American Society for Microbiology All Rights Reserved Cleavage and Activation of the Severe Acute Respiratory Syndrome Coronavirus Spike Protein by Human Airway Trypsin Like Protease H17188 Stephanie Bertram 1 2 Ilona Glowacka 1 Marcel A Mu ller 3 Hayley Lavender 4 Kerstin Gnirss 1 Inga Nehlmeier 2 Daniela Niemeyer 3 Yuxian He 5 Graham Simmons 6 Christian Drosten 3 Elizabeth J Soilleux 7 8 Olaf Jahn 9 Imke Steffen 1 6 and Stefan Po hlmann 1 2 Institute of Virology Hannover Medical School Hannover Germany 1 German Primate Center Go ttingen Germany 2 Institute of Virology University of Bonn Medical Centre Bonn Germany 3 Oxfabs Nuffield Department of Clinical Laboratory Sciences John Radcliffe Hospital University of Oxford Oxford United Kingdom 4 Institute of Pathogen Biology Chinese Academy of Medical Sciences and Peking Union Medical College Beijing China 5 Blood Systems Research Institute and Department of Laboratory Medicine University of California San Francisco California 6 Department of Cellular Pathology John Radcliffe Hospital Oxford United Kingdom 7 Nuffield Department of Clinical Laboratory Sciences John Radcliffe Hospital University of Oxford United Kingdom 8 and Proteomics Group Max Planck Institute of Experimental Medicine Go ttingen Germany 9 Received 6 June 2011 Accepted 21 September 2011 The highly pathogenic severe acute respiratory syndrome coronavirus SARS CoV poses a constant threat to human health The viral spike protein SARS S mediates host cell entry and is a potential target for antiviral intervention Activation of SARS S by host cell proteases is essential for SARS CoV infectivity but remains incompletely understood Here we analyzed the role of the type II transmembrane serine proteases TTSPs human airway trypsin like protease HAT and transmembrane protease serine 2 TMPRSS2 in SARS S activation We found that HAT activates SARS S in the context of surrogate systems and authentic SARS CoV infection and is coexpressed with the viral receptor angiotensin converting enzyme 2 ACE2 in bronchial epithelial cells and pneumocytes HAT cleaved SARS S at R667 as determined by mutagenesis and mass spectrometry and activated SARS S for cell cell fusion in cis and trans while the related pulmonary protease TMPRSS2 cleaved SARS S at multiple sites and activated SARS S only in trans However TMPRSS2 but not HAT expression rendered SARS S driven virus cell fusion independent of cathepsin activity indicating that HAT and TMPRSS2 activate SARS S differentially Collectively our results show that HAT cleaves and activates SARS S and might support viral spread in patients The severe acute respiratory syndrome coronavirus SARS CoV is the causative agent of a novel lung disease SARS which was first observed in Guangdong Province southern China in 2002 32 33 Subsequently SARS spread to more than 30 countries with 8 096 cases About 10 of the afflicted individuals died from the disease with elderly patients being disproportionally affected 32 33 The emergence of the SARS CoV was traced back to palm civets and other animals sold in Chinese wet markets 15 It is believed that these animals serve as intermediate hosts while Chinese horseshoe bats which harbor SARS CoV related viruses constitute a natural reservoir 27 29 The circulation of SARS CoV in an animal reservoir poses the continuous threat of reintroduction of the virus into the human population Therefore the devel opment of preventive and therapeutic measures is required and host cell factors essential for spread of SARS CoV and potentially other respiratory viruses are attractive targets The SARS CoV spike protein SARS S jointly with the viral M and E proteins is incorporated into the viral mem brane and SARS S mediates infectious viral entry into target cells 20 For this SARS S needs to bind to a receptor on the host cell surface and to fuse the viral membrane with a host cell membrane thereby allowing delivery of SARS CoV proteins and genomic information into the host cell cytoplasm the location of SARS CoV replication 20 43 Angiotensin con verting enzyme 2 ACE2 has been identified to be the SARS CoV receptor 28 and was found to be expressed on type II pneumocytes and enterocytes major viral target cells 16 31 46 47 ACE2 expression protects against experimentally in duced lung disease and viral interference with receptor ex pression might contribute to SARS pathogenesis 22 25 Receptor engagement and membrane fusion are accom plished by two separate subunits in SARS S the N terminal surface unit S1 receptor binding and the C terminal trans membrane unit S2 membrane fusion In order to transit into an active state viral glycoproteins with an architecture similar to that of SARS S termed class I fusion proteins frequently depend on cleavage by host cell proteases 20 An initial study indeed suggested that efficient SARS CoV spread might de pend on SARS S activation by furin 3 but these findings were not substantiated by subsequent work A seminal study by Simmons and colleagues revealed that cathepsins pH depen Corresponding author Mailing address Infection Biology Unit German Primate Center Kellnerweg 4 37077 Go ttingen Germany Phone 49 551 3851 150 Fax 49 551 3851 184 E mail s poehlmann dpz eu S B I G and M A M contributed equally to this work H17188 Published ahead of print on 12 October 2011 13363 dent endo lysosomal cysteine proteases activate SARS S 40 Thus binding of SARS CoV to ACE2 is thought to trig ger receptor mediated endocytosis and transport of virions into host cell endosomes 48 where SARS S is activated for membrane fusion upon cleavage by cathepsin L 40 Conse quently it was proposed that cathepsin inhibitors could be developed for therapy of SARS CoV infection 40 and such efforts are under way 36 Type II transmembrane serine proteases TTSPs play an important role in development and homeostasis and dysregu lated TTSP expression is a hallmark of different cancers 10 Human influenza viruses parasitize transmembrane protease serine 2 TMPRSS2 and human airway trypsin like protease HAT members of the TTSP family to facilitate their acti vation 5 7 9 TMPSS2 has also recently been shown to cleave and activate SARS S for cell cell and virus cell fusion thereby allowing cathepsin independent host cell entry 14 30 38 Whether HAT plays a role in SARS S activation is at present unknown Here we report that HAT cleaves SARS S at position R667 and activates SARS S for cell cell fusion while TMPRSS2 has multiple cleavage sites in SARS S and activates SARS S for cell cell and virus cell fusion HAT was found to be coex pressed with ACE2 in human lung epithelium indicating that this protease could promote viral spread in patients MATERIALS AND METHODS Plasmids Expression plasmids pCAGGS SARS S encoding the spike protein of the Frankfurt strain of SARS CoV and pcDNA3 hACE2 encoding human ACE2 hACE2 have been described previously 18 19 The plasmids encoding human TMPRSS2 TMPRSS3 TMPRSS4 TMPRSS6 and hepsin have also been described previously 9 24 35 37 HAT was PCR amplified from cDNA from human bronchus employing primers p5 EcoRI HAT GCGAATTCACC ATGTATAGGCCAGCACGTGTAACTTCG and p3 NheI HAT GCGCTA GCGCCTAGATCCCAGTTTGTTGCCTAATCC The PCR product was in serted into pCAGGS via EcoRI and NheI and controlled by sequencing Cell culture 293T cells were propagated in Dulbecco s modified Eagle s me dium DMEM supplemented with 10 fetal bovine serum FBS penicillin and streptomycin and were grown in a humidified atmosphere containing 5 CO 2 293T cells stably expressing ACE2 293T hACE2 were generated by trans fection of plasmid pcDNA3 1zeo hACE2 18 into 293T cells followed by se lection of resistant cells with zeocin Invitrogen at 50 H9262g ml as previously reported 13 Homogeneous surface expression of ACE2 on stably transfected cells was confirmed by flow cytometry Cleavage of cellular SARS S by HAT For detection of cleavage of SARS S by HAT and other TTSPs 293T cells were cotransfected with SARS S expression plasmid jointly with a TTSP expression plasmid or empty plasmid At 6 to 8 h posttransfection the medium was changed and at 48 h posttransfection the cells were washed once with 1H11003 phosphate buffered saline PBS and lysed in 2H11003 sodium dodecyl sulfate SDS loading buffer For immunoblotting the lysates were separated by SDS gel electrophoresis and transferred onto nitrocellulose membranes SARS S protein was detected by staining with a rabbit serum spe cific for the S1 subunit generated by immunization with a peptide comprising SARS S amino acids 19 to 48 17 For loading control the stripped membranes were incubated with an anti H9252 actin antibody Sigma VLPs For production of virus like particles VLPs 293T cells were cotrans fected with the HIV 1 Gag p55 encoding plasmid p96ZM651gag opt 12 SARS S expression plasmid TTSP expression plasmid or empty vector The cellular supernatants were harvested at 48 h posttransfection and concentrated by ultrafiltration employing VivaSpin centrifugal concentrators Sartorius Sub sequently VLPs were purified from concentrated supernatants by ultracentrif ugation through a 20 sucrose cushion for2hat25 000 rpm and 4 C Finally supernatants and pellets of the ultracentrifuge reactions were treated with PBS or trypsin followed by addition of soybean trypsin inhibitor Sigma and analysis by Western blotting employing a commercially available antibody directed against the S2 subunit of SARS S Imgenex In addition the presence of HIV Gag in pellets and supernatants was detected using anti p24 hybridoma super natant 183 H12 5C HAT dependent activation of SARS S for cell cell fusion The cell cell fusion assay was carried out essentially as described previously 14 21 39 For analysis of SARS S driven cell cell fusion in the absence of TTSPs 293T effector cells seeded in 6 well plates at 1 2 H11003 10 5 well were CaPO 4 transfected with either SARS S expression plasmid or empty plasmid negative control in combination with plasmid pGAL4 VP16 which encodes the herpes simplex virus VP16 trans activator fused to the DNA binding domain of the Saccharomyces cerevisiae transcription factor GAL4 21 In parallel 293T target cells were seeded in 48 well plates at 0 8 H11003 10 5 well and transfected with either hACE2 encoding plasmid or empty vector negative control together with plasmid pGal5 luc which encodes the luciferase reporter gene under the control of a promoter containing five GAL4 binding sites For analysis of SARS S activation by HAT and other TTSPs in cis the fusion assay was carried out as described above but effector cells were additionally transfected with a TTSP expression plasmid In order to determine SARS S activation by HAT and other TTSPs in trans the fusion assay was carried out as described above but target cells were additionally transfected with a TTSP expression plasmid At 24 h posttransfection the effec tor cells were detached by pipetting resuspended in fresh medium and added to the target cells At 6 h postcocultivation medium supplemented with trypsin final concentration 100 ng ml Sigma or PBS was added to the samples At 16 h after trypsin treatment medium was completely removed and fresh culture medium without trypsin was added Finally at 24 h after medium change the cell cell fusion was quantified by determination of luciferase activities in cell lysates using a commercially available kit Promega Activation of SARS S bearing lentiviral pseudotypes by HAT Lentiviral pseu dotypes bearing SARS S were essentially generated as described previously 14 21 39 41 In brief 293T cells were transiently cotransfected with pNL4 3 E R Luc 11 SARS S expression plasmid and either TTSP expression plasmid or empty plasmid At 16 h posttransfection the culture medium was replaced by fresh medium and at 48 h posttransfection culture supernatants were harvested The supernatants were passed through 0 45 H9262m pore size filters aliquoted and stored at H1100280 C In order to analyze cis activation of virus cell fusion pseu dotypes generated in TTSP expressing cells were used for infection experiments Specifically equal volumes of pseudotypes normalized for comparable infectivity for 293T hACE2 cells were employed for infection of 293T hACE2 cells pre treated for 30 min at 37 C with the indicated concentrations of ammonium chloride or the cathepsin inhibitor MDL28170 Calbiochem At 16 h postinfec tion the infection medium was replaced by fresh culture medium without inhib itor and at 72 h postinfection luciferase activities in cell lysates were determined employing a commercially available kit Promega For the assessment of trans activation of virus cell fusion the assay was carried out as described for the cis setting except that pseudotypes produced in the absence of TTSP expression were used for infection of 293T hACE2 target cells transfected to express TTSPs HAT dependent syncytium formation 293T hACE2 cells 2 H11003 10 5 cells per ml were seeded on cover slides in 24 wells and were transfected with 1 H9262g HAT TMPRSS2 or TMPRSS4 expression plasmids or transfected with empty control plasmid pCAGGS using X tremeGENE reagent Roche according to the manual instructions After 24 h cells were infected with SARS CoV Frank furt 1 multiplicity of infection 0 1 for 30 min at 4 C and slides were fixed with paraformaldehyde 8 after another 24 h Cells were permeabilized with 0 1 Triton X 100 and SARS CoV antigen was detected by immunostaining by applying a SARS patient antiserum diluted 1 100 In parallel proteases were detected with mouse anti HAT R Life Technologies all diluted 1 100 and nuclei were stained with 4H11032 6 diamidino 2 phenylindole DAPI Secondary detec tion was performed with Cy3 conjugated goat anti human 1 200 and Cy2 labeled goat anti mouse 1 200 antibodies Dianova All pictures were taken with the help of an Axio Imager M1 fluorescence microscope Zeiss Digest of recombinant SARS S by recombinant HAT Eight micrograms of recombinant SARS S rSARS S Beijing 02 produced in 293T cells and ob tained from a commercial source Geneimmune was incubated with 200 ng HAT R R S1 S1 subunit of SARS S asterisks SARS S cleavage fragments generated by TMPRSS2 B HAT cleaves SARS S at arginine 667 Plasmids encoding wild type SARS S or the SARS S R667A mutation were transfected into 293T cells jointly with TMPRSS2 HAT expression plasmids or empty vector pcDNA Subsequently the cells were treated with PBS or trypsin and SARS S cleavage was analyzed by Western blot analysis of cell lysates using an S1 specific antiserum Expression of H9252 actin in cell lysates was assessed as a loading control C Cleavage of recombinant SARS S rSARS S by recombinant HAT Recombinant SARS S was incubated with the indicated concentrations of recombinant HAT and cleavage products were analyzed by Western blot analysis employing a SARS S1 specific serum Recombinant HAT was also detected D Separation of SARS S cleavage products for mass spectrometric analysis SARS S cleavage products were separated by gel electrophoresis and visualized by colloidal Coomassie staining Major differential bands appearing upon HAT treatment see apparent molecular mass annotations on the right were subjected to in gel digest with trypsin or Asp N followed by mass spectrometric analysis Thereby we identified the 130 kDa band to be S2 with its N terminus starting at S668 and the 95 kDa band to be S1 with its C terminus ending at R667 Untreated SARS S 170 kDa band in the left lane was processed in parallel as a control VOL 85 2011 PROTEOLYTIC ACTIVATION OF SARS S 13365 mouse monoclonal antibody 337029 R UC Sup VLP preparation subjected to ultrafiltration followed by ultracentrif ugation and analysis of the supernatants of ultracentrifuge reactions S Fl full length SARS S S2 S2 subunit of SARS S asterisks SARS S cleavage fragments generated by TMPRSS2 VOL 85 2011 PROTEOLYTIC ACTIVATION OF SARS S 13367 target cells or by trypsin treatment 14 39 which both ensure efficient SARS S activation Employing this cell cell fusion assay we first tested if coexpres sion of HAT in S protein expressing effector cells enhances cell cell fusion activity cis activation For this effector cells were transfected with SARS S expression plasmid and a TTSP expres sion plasmid or empty plasmid Effector cells transfected with empty plasmid alone served as negative controls Target cells were transfected with an ACE2 expression plasmid or empty plasmid Subsequently effector and target cells were mixed and treated with trypsin or PBS and the rate of efficiency of cell cell fusion was determined at 48 h after cell mixing The presence of SARS S in effector cells was critical for cell cell fusion as ex pected Fig 4A pcDNA In the absence of exogenous ACE2 expression on target cells and trypsin treatment or expression of TTSPs no notable S protein driven cell cell fusion was observed pcDNA SARS S white bar Trypsin treatment overcame low level receptor expression on target cells and led to a substantial increase in the fusogenic activity of SARS S pcDNA SARS S gray bar as expected 39 Fig 4A Similarly ACE2 overex pression augmented cell cell fusion which was further enhanced by trypsin treatment pcDNA SARS S lined bar and black bar respectively in agreement with our recent findings 14 39 Ex pression of TMPRSS2 TMPRSS3 TMPRSS4 TMPRSS6 and hepsin TTSPs previously examined for their ability to activate SARS S 14 and influenza virus hemagglutinin 4 in SARS S transfected effector cells had no marked influence on the fuso genic activity of SARS S Fig 4A In contrast HAT efficiently activated SARS S for fusion with target cells expressing endoge nous ACE2 indicating that SARS S cleavage in cis by HAT but not TMPRSS2 activates SARS S for cell cell fusion To address whether HAT can also activate SARS S in trans the cell cell fusion assay was carried out as described above but TTSPs were expressed in target instead of effector cells Expression of TMPRSS3 TMPRSS6 and hepsin in target cells had no effect on SARS S driven cell cell fusion while expres sion of TMPRSS2 or TMPRSS4 markedly increased the fuso genic activity of SARS S Fig 4B in agreement with our published results 14 The same observation was made for expression of HAT which induced efficient SARS S driven cell cell fusion with target cells expressing endogenous low levels of ACE2 Fig 4B Thus HAT activates the SARS spike protein both in cis and in trans while activation of SARS S by TMPRSS2 occurs only in trans FIG 4 HAT activates SARS S for cell cell fusion in cis and in trans A cis activation of SARS S by HAT 293T effector cells were cotransfected with pGAL4 VP16 expression plasmid SARS S plasmid and plasmids encoding the indicated proteases or empty plasmid pcDNA and mixed with target cells cotransfected with ACE2 expression plasmid or empty plasmid and a plasmid encoding luciferase under the control of a promoter with five GAL4 binding sites The cell mixtures were then treated with PBS or trypsin and the luciferase activities in cell lysates were quantified at 48 h after cell mixing The results of a representative experiment performed in triplicate are shown error bars indicate standard deviations SDs Similar results were observed in an independent experiment B trans activation of SARS S by HAT The cell cell fusion assay was performed as described in the legend for panel A but proteases were expressed in target cells The results of a representative experiment performed in triplicate are shown and were confirmed in two separate experiments Error bars indicate SDs 13368 BERTRAM ET AL J VIROL Cleavage activation of SARS S by HAT does not bypass the need for cathepsin activity The pH dependent protease cathep sin L can activate SARS S for virus cell fusion 40 Accordingly SARS S driven virus cell fusion can be inhibited by the lysoso motropic agent ammonium chloride NH 4 Cl and the cathepsin inhibitor MD