《【病毒外文文獻(xiàn)】2016 Two-tube multiplex real-time reverse transcription PCR to detect six human coronaviruses》由會員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2016 Two-tube multiplex real-time reverse transcription PCR to detect six human coronaviruses（4頁珍藏版）》請在裝配圖網(wǎng)上搜索。

VIROLOGICA SINICA 2016 31 1 85 88 DOI 10 1007 s12250 015 3653 9 LETTER Two tube multiplex real time reverse transcription PCR to detect six human coronaviruses Dear Editor Coronaviruses are enveloped positive strand RNA vir uses with 27 33 kb genomes These viruses are classi fied into four genera namely Alphacoronavirus Betacor onavirus Gammacoronavirus and Deltacoronavirus Adams and Carstens 2012 The Middle East respirat ory syndrome coronavirus MERS CoV which was first and only recently identified in the Middle East belongs to the genus Betacoronavirus Zaki et al 2012 The hu man coronaviruses HCoV NL63 HCoV 229E SARS CoV HCoV OC43 MERS CoV and HCoV HKU1 are associated with high morbidity respiratory distress in cluding acute respiratory tract infection pneumonia and bronchiolitis Gaunt et al 2010 Zaki et al 2012 Lu et al 2014 Of these HCoV NL63 HCoV 229E HCoV OC43 and HCoV HKU1 are frequently isolated from patients and are globally distributed although preval ence varies with time and geographical region Geng and Tan 2013 On the other hand an outbreak of SARS between 2002 and 2003 afflicted approximately 8 000 people with 774 deaths Stadler et al 2003 Timely diagnosis is critical in managing coronavirus infections and in tracing possible sources Many early diagnostic technologies relied on cumbersome and in sensitive methods such as serology virus cultures and antigen detection Molecular diagnostic tests have since confirmed that coronaviruses are causative agents of res piratory distress and have allowed identification to spe cies Today reverse transcription polymerase chain reac tion RT PCR real time PCR with melt curve analysis and probe based real time RT PCR are routinely used to detect human coronaviruses in nasopharyngeal swabs Theamboonlers et al 2007 Gaunt et al 2010 However these techniques have limited sensitivity or are low throughput precluding rapid screening of large numbers of samples In this study we developed a two tube multiplex real time RT PCR assay for sensitive and specific detection of all known human coronaviruses Total nucleic acids were extracted from 100 L samples using QIAamp Vir al RNA Mini Kit Primer sets Table 1 quoted from the references were modified based on the Nucleotide Col lection Database National Center for Biotechnology In formation Bethesda MD USA for our study using Primer Premier 5 0 Different primer and probe combina tions were evaluated in preliminary experiments Based on these experiments primers for NL63 229E and SARS were grouped into one triplex reaction while those for MERS OC43 and HKU1 were grouped into another Table 1 Viral targets were amplified on a CFX96 real time PCR system Bio Rad USA using One Step RT PCR Enzyme Mix TaKaRa Japan in 25 L reactions containing 12 5 L 2 PCR buffer 0 5 L RT enzyme mix 0 5 L Taq enzyme mix 2 L template DNA as well as primers and probes added from 10 mixtures Final concentrations are listed Table 1 Reac tions consisted of 5 min reverse transcription at 42 C 10 s denaturation at 95 C and 40 cycles at 95 C for 10 s and 62 C for 45 s Human RNase P gene was ampli fied as internal control Data were analyzed by univari ate statistics and binary logistic regression P values 0 05 were considered statistically significant Preliminary experiments indicate that the two tube multiplex assay was internally specific for each coronavi rus Importantly cross reactivity was not observed with influenza A virus influenza B virus parainfluenza virus 1 4 respiratory syncytial virus metapneumovirus aden ovirus bocavirus rhinovirus echovirus mumps virus measles virus and Staphylococcus aureus Sensitivity was assessed using in vitro transcripts of all six coronaviruses which were obtained using a T7 large scale RNA production system Promega WI USA These transcripts were serially diluted 10 fold and amplified in triplicate by two tube multiplex RT PCR and by previously established monoplex RT PCR We found that Ct values did not differ significantly between monoplex and multiplex reactions data not shown PCR products were cloned into pGEM T Easy and confirmed by sequencing Detection limits were de termined using samples containing one virus or all six viruses in equal proportion Standard curves were gener ated from samples containing one virus by plotting Ct values against the log of copies L Supplementary Figure S1 The high sensitivity of the assay was confirmed us ing synthesized RNA standards at 10 copies reaction To obtain additional performance data and explore Wuhan Institute of Virology CAS and Springer Science Business Media Singapore 2016 FEBRUARY 2016 VOLUME 31 ISSUE 1 85 possible applications we tested the ability of two tube multiplex RT PCR to detect viral RNA in monkeys ex perimentally infected with known titers of MERS CoV Yao et al 2014 The MERS CoV strain hCoV EMC was generously provided by Drs Fouchier and Haag mans at Erasmus Medical Centre The Netherlands and was propagated and titered in Vero cells Swabs from in fected monkeys were collected according to published methods Yao et al 2014 by Professor Qin Chuan at In stitute of Laboratory Animal Sciences Chinese Academy of Medical Sciences Viral RNA was detected in nasal throat and anal swabs within two days of infection after which point viral RNA was most abundant in throat swabs Supplementary Table S1 Notably multiplex PCR was able to distinguish virus from Vero cell cul tures at different titers Supplementary Figure S2 In addition we tested the performance of two tube real time RT PCR against whole blood and pharyngeal swabs collected in 2015 in Guangdong Province China from a Korean patient with suspected MERS Lu et al 2015 The virus was detected in all specimens Supple mentary Table S1 Results were comparable to in house monoplex RT PCR reactions Lu et al 2014 Moreover we assessed the ability of two tube multi plex RT PCR to monitor HCoV HKU1 propagation in human airway epithelial cells Zhu et al 2015 The HCoV HKU1 stock was provided by the National Insti tute for Viral Disease Control and Prevention Chinese Center for Disease Control and Prevention Copies of HCoV HKU1 RNA increased with time peaking at 96 h post inoculation Supplementary Table S2 in line with in house monoplex reactions Dare et al 2007 Finally clinical performance was evaluated using 346 nasopharyngeal swabs obtained in 2014 from children under 14 years who were hospitalized with acute respir atory infection This study was approved by the Institu tional Review Boards of the Chinese Center for Disease Control and Prevention and written informed consent Table 1 Primers for two tube multiplex real time RT PCR Virus target Target gene Primer Sequence Concentration nmol L Reference Multiplex PCR 1 HCoV NL63 Nucleoprotein Forward AGGACCTTAAATTCAGACAACGTTCT 100 Theamboon lers et al 2007 Reverse GATTACGTTTGCGATTACCAAGACT 50 Probe FAM TAACAGTTTTAGCACCTTCCTTAGCAACCCAAACA TAMRA 25 HCoV 229E Nucleoprotein Forward CGCAAGAATTCAGAACCAGAG 50 Adapted from Theamboon lers et al 2007 Reverse GGCAGTCAGGTTCTTCAACAA 75 Probe HEX CCACACTTCAATCAAAAGCTCCCAAATG TAMRA 25 SARS CoV Nucleoprotein Forward TGGACCCACAGATTCAACTGA 50 Adapted from Theamboon lers et al 2007 Reverse GCTGTGAACCAAGACGCAGTAT 50 Probe CY5 TAACCAGAATGGAGGACGCAATGG BHQ2 25 Multiplex PCR 2 HCoV OC43 Nucleoprotein Forward GCTCAGGAAGGTCTGCTCC 50 Theamboon lers et al 2007 Reverse TCCTGCACTAGAGGCTCTGC 25 Probe FAM TTCCAGATCTACTTCGCGCACATCC TAMRA 25 MERS CoV Nucleoprotein Forward GGCACTGAGGACCCACGTT 50 Adapted from Lu et al 2014 Reverse TTGCGACATACCCATAAAAGCA 50 Probe CY5 CCCCAAATTGCTGAGCTTGCTCCTACA BHQ2 25 HCoV HKU1 Replicase 1b Forward CCTTGCGAATGAATGTGCT 50 Adapted from Dare et al 2007 Reverse TTGCATCACCACTGCTAGTACCAC 375 Probe HEX TGTGTGGCGGTTGCTATTATGTTAAGCCTG TAMRA 25 Two tube multiplex real time RT PCR for detection of six HCoVs 86 FEBRUARY 2016 VOLUME 31 ISSUE 1 VIROLOGICA SINICA was obtained from parents or guardians of all patients As shown in Table 2 two tube multiplex real time RT PCR detected viruses in 24 6 94 samples of which five 1 46 were infected with NL63 and 10 2 89 were infected with 229E Six samples 1 73 tested positive for OC43 and HKU1 was detected in three 0 87 samples There were no differences between two tube multiplex real time RT PCR and a previously established one tube multiplex RT PCR assay with in line electrophoresis QIAxcel Qiagen Niu et al 2014 In addition co infection was detected by both assays in three patients 0 87 of whom one was co infected with NL63 and 229E while the other two were co infec ted with OC43 and 229E Table 2 Infection was con firmed data not shown by in house monoplex real time PCR Lu et al 2012 Notably one case of OC43 and two cases of HKU1 were detected by two tube multi plex RT PCR but not by one tube multiplex RT PCR with inline electrophoresis Nested RT PCR and gene se quencing confirmed results from two tube multiplex RT PCR data not shown highlighting its potentially high er sensitivity for these viruses Real time RT PCR is an established rapid and effect ive method to detect multiple viral pathogens of the res piratory tract Dare et al 2007 Gaunt et al 2010 Lu et al 2012 We have developed a sensitive and specific real time RT PCR assay to detect all six human coronav iruses Its ability to monitor HKU1 replication in cul tures of human airway epithelial cells to quantitatively measure viral RNA in monkeys experimentally infected with MERS and to detect MERS in a human patient was demonstrated In addition the assay was used to assess disease burden and epidemiology of coronaviruses among hospitalized patients with acute respiratory infec tion and able to detect co infection Finally the assay re quires significantly less sample than monoplex real time RT PCR Thus the assay will be widely used in coronav irus research FOOTNOTES The authors thank Dr Bart Haagmans and Ron Fouchier at Erasmus Medical Center Rotterdam the Netherlands for provid ing MERS CoV isolate hCoV EMC 2012 We also thank Dr Qin Chuan at Institute of Laboratory Animal Sciences Chinese Academy of Medical Sciences for providing swabs from rhesus monkeys challenged with MERS CoV This work was supported by grants from the State Megaproject for Infectious Disease Re search of China 2014ZX10004001 002 2013ZX10004101 2013ZX10004805 002 The funding agency did not participate in study design data collection and analysis decision to publish or preparation of the manuscript The authors declare that they have no conflict of interest All the animal tests comply with Chinese Center for Disease Control and Prevention laboratory animal man agement approach and the requirement of animal welfare Written informed consent was obtained from parents or guardians of all patients Supplementary figures tables are available on the website of Viro logica Sinica www virosin org Peihua Niu1 Jun Shen2 Na Zhu1 Roujian Lu1 Wenjie Tan1 1 Key Laboratory of Medical Virology Ministry of Health National Institute for Viral Disease Control and Prevention Chinese Center for Disease Control and Prevention Beijing 102206 China Table 2 Detection of coronavirus in 346 clinical samples Target Two tube multiplex real time RT PCR One tube multiplex real time RT PCR with inline electrophoresis Range of Ct values Positive samples Positive samples HCoV NL63 25 33 5 5 1 46 5 1 46 HCoV 229E 26 34 10 2 89 10 2 89 SARS CoV 0 0 HCoV OC43 26 35 6 1 73 5 1 46 MERS CoV 0 0 HCoV HKU1 28 34 5 3 0 87 1 0 29 Co infectiona 3 0 87 3 0 87 Total 25 35 24 6 94 21 6 1 Note aHCoV NL63 and HCoV 229E n 1 HCoV OC43 and HCoV 229E n 2 Peihua Niu et al www virosin org FEBRUARY 2016 VOLUME 31 ISSUE 1 87 2 Children s Hospital of Fudan University Shanghai 200032 China Correspondence Phone 86 10 58900878 Fax 86 10 58900878 Email tanwj28 These authors contributed equally to this work ORCID 0000 0002 5963 1136 Published online 25 January 2016 REFERENCES Adams MJ Carstens EB 2012 Arch Virol 157 1411 1422 Dare RK Fry AM Chittaganpitch M et al 2007 J Infect Dis 196 1321 1328 Gaunt ER Hardie A Claas EC et al 2010 J Clin Microbiol 48 2940 2947 Geng H Tan W 2013 Sci China Life Sci 56 683 687 Lu R Wu J Niu P et al 2015 Chin J Exp Clin Virol 29 193 195 In Chinese Lu R Yu X Wang W et al 2012 PLoS One 7 e38638 Lu X Whitaker B Sakthivel SK et al 2014 J Clin Microbiol 52 67 75 Niu P Zhang C Lu R et al 2014 Chin J Prev Med 48 416 419 In Chinese Stadler K Masignani V Eickmann M et al 2003 Nat Rev Microbiol 1 209 218 Theamboonlers A Samransamruajkit R Thongme C et al 2007 Interviro logy 50 71 77 Yao Y Bao L Deng W et al 2014 J Infect Dis 209 236 242 Zaki AM van Boheemen S Bestebroer TM et al 2012 N Engl J Med 367 1814 1820 Zhu N Niu P Zhao Y et al 2015 Chin J Exp Clin Virol 29 80 82 In Chinese Two tube multiplex real time RT PCR for detection of six HCoVs 88 FEBRUARY 2016 VOLUME 31 ISSUE 1 VIROLOGICA SINICA