《【病毒外文文獻(xiàn)】2004 Expression of SARS-coronavirus envelope protein in Escherichia coli cells alters membrane permeability》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2004 Expression of SARS-coronavirus envelope protein in Escherichia coli cells alters membrane permeability（7頁珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

J P ity September Abstract agent of the recent epidemic of severe acute respiratory dent RNA polymerase and helicase involved in the genomic and subgenomic RNA synthesis The four 3 0 are encoded by subgenomic mRNA 2 4 5 and 9 of early CPE in cells infected with most coronaviruses The prominent CPE in cells infected with SARS CoV however is rounding up of the infected cells cell detachment and lysis 9 Typically two types of mem brane active proteins are able to modify membrane Corresponding author Fax 65 67791117 E mail address dxliu imcb a star edu sg D X Liu Biochemical and Biophysical Research Communica 0006 291X see front matter C211 2004 Elsevier Inc All rights reserved syndrome SARS 18 Similar to other coronaviruses SARS coronavirus SARS CoV is an enveloped virus with a single strand positive sense RNA genome of 29 7 kb in length Upon virus entry into cells a 3 0 coter minal nested set of 9 mRNAs is produced 20 The gen ome length mRNA mRNA1 expresses two overlapping replicase proteins in the form of polypro teins 1a and 1a b The polyproteins are subsequently processed into at least 16 putative nonstructural pro teins NSP1 NSP16 by virus encoded proteinases 20 The mature proteins comprise proteinases RNA depen respectively In addition eight putative nonstructural proteins 3a 3b 6 7a 7b 8a 8b and 9b are encoded by mRNA3 6 7 8 and 9 respectively 20 They are un ique proteins of SARS CoV and very little is known about the functions of these nonstructural proteins 18 20 Coronavirus infection of cultured cells causes typical cytopathic e ects CPEs including rounding up and fusion of the infected cells detachment of cells from the culture dishes cell lysis and death 13 Among them formation of giant syncytial cells is the hallmark To promote viral entry replication release and spread to neighboring cells many cytolytic animal viruses encode proteins responsible for modification of host cell membrane permeability and for formation of ion channels in host cell membranes during their life cycles In this study we show that the envelope E protein of severe acute respiratory syndrome associated coronavirus can induce membrane permeability changes when expressed in Escherichia coli E protein expressed in bacterial and mammalian cells under reducing conditions existed as monomers but formed homodimer and homotrimer under non reducing conditions Site di rected mutagenesis studies revealed that two cysteine residues of the E protein were essential for oligomerization leading to induc tion of membrane permeability This is the first report demonstrating that a coronavirus encoded protein could modify membrane permeability in E coli cells C211 2004 Elsevier Inc All rights reserved Keywords Severe acute respiratory syndrome coronavirus Envelope protein Membrane permeability Escherichia coli E protein Oligomerization Viroporin A novel coronavirus was identified as the causative structural proteins arranged in the order 5 0 S E M N Expression of SARS coronavirus Escherichia coli cells alters Y Liao a J Lescar a a School of Biological Science Nanyang Technological Univers b Institute of Molecular and Cell Biology 61 Biopolis Received 27 doi 10 1016 j bbrc 2004 10 050 envelope protein in membrane permeability Tam a D X Liu a b 61 Biopolis Drive Proteos Singapore 138673 Singapore Drive Proteos Singapore 138673 Singapore 2004 tions 325 2004 374 380 BBRC hydrophilic pores in the plasma membrane and inducing a general increase in permeability to ions and small mol Y Liao et al Biochemical and Biophysical Research Communications 325 2004 374 380 375 ecules but not to macromolecules 4 7 Viroporins have been found in many viruses such as HCV p7 protein 8 15 human immunodeficiency virus type 1 HIV 1 Vpu 6 influenza A virus M2 16 hepatitis A virus 2B 10 Semliki Forest virus 6K 19 picornavirus 2B 1 2 11 and avian reovirus p10 protein 3 In this study we aimed to identify and characterize SARS CoV proteins that may induce membrane per meability upon expression in bacterial cells Among five proteins tested the E protein can obviously en hance membrane permeability to o nitrophenyl b D ga lactopyranoside ONPG a b galactosidase substrate and hygromycin B HB an antibiotic which can inhi bit protein synthesis Analysis of the E protein ex pressed in bacterial and mammalian cells demonstrated that the protein may form homodimer and homotrimer and site directed mutagenesis studies revealed that two cysteine residues of the E protein lo cated at amino acid positions 40 and 44 are essential for the formation of oligomers and for induction of membrane permeability in Escherichia coli cells These results together with the predicted structural similarity with known membrane permeable proteins of other viruses suggest that the E protein might be a putative viroporin Experimental procedures Transient expression of SARS CoV sequence in mammalian cells HeLa cells were grown at 37 C176Cin5 CO 2 and maintained in Glas gowC213s modified EagleC213s medium supplemented with 10 fetal calf serum SARS CoV sequences were placed under the control of a T7 pro moter and transiently expressed in mammalian cells using a vaccinia virus T7 expression system Briefly 60 80 confluent monolayers of HeLa cells grown on 35 mm dishes Falcon were infected with 10 plaque forming units cell of a recombinant vaccinia virus vTF7 3 that expresses T7 RNA polymerase Two hours later cells were transfected with 5 lg of plasmid DNA mixed with transfection reagent DOTAP according to the instructions of the manufacturer Roche The transfection mixture was replaced with fresh culture medium 6 h permeability leading to lysis of virus infected cells 4 7 The first type of these membrane active proteins is the viral proteins with fusogenic activity One exam ple of such proteins is the hepatitis C virus HCV E1 protein 5 The second type is a group of small hydro phobic proteins termed viroporins 4 7 Viroporins are small highly hydrophobic viral pro teins that could interact with cellular membranes and modify membrane permeability to ions or other small molecules In this manner viroporins disorganize the membrane cause cell lysis and facilitate the release of viral progeny This group of viral proteins is usually ex pressed at late stages of the infection cycles forming post transfection Cells were harvested and stored at C080 C176C Expression of proteins in E coli Plasmids were transformed into E coli strain BL21 DE3 A single colony was grown in LB medium overnight and then diluted 100 fold in LB medium or M9 medium supplemented with 0 2 glucose When the absorbance of the cultures reached 0 6 at 600 nm 1 mM IPTG was added to the medium to in duce protein synthesis At indicated times post induction the cell density of bacterial cultures was determined by measuring the light scattering at 600 nm Western blot analysis Total protein from bacterial or HeLa cells was lysed with 2 SDS loading bu er with or without 200 mM DTT plus 10 mM of iodoacetamide and subjected to SDS PAGE Proteins were transferred to PVDF membrane Stratagene and blocked over night at 4 C176C in blocking bu er 5 fat free milk powder in TBST bu er 20 mM Tris HCl pH 7 4 150 mM NaCl and 0 1 Tween 20 The membrane was incubated with a 1 1000 diluted primary antibody in blocking bu er for 1 h at room temperature After washing three times with TBST the membrane was incubated with 1 2000 diluted anti mouse IgG conjugated with horseradish peroxidase DAKO in blocking bu er for 1 h at room temperature After washing for three times with TBST the polypeptides were detected with a chemilumi nescence detection kit ECL Amersham Biosciences according to the instructions of the manufacturer b Galactosidase and hygromycin B assays To measure the entry of ONPG into bacterial cells 1 ml of bacterial cultures was removed at indicated times post induction After centrifugation cells were re suspended in 1 ml of fresh M9 medium containing 2 mM ONPG a b galactosidase substrate Cells were incubated for 10 min at 30 C176C and the reaction was stopped by addition of 0 4 ml of 1 M sodium car bonate Samples were centrifuged and the absorbance at 420 nm was measured to estimate the cleavage of ONPG To detect the entry of HB into bacterial cells 1 mM of HB was added to the medium 50 min post induction After incubation for 30 min 1 lCi of 35 S methionine per ml was added to the medium and incubated at 37 C176C for 15 min The bacterial cells were then harvested and subjected to SDS PAGE The proteins were detected by autoradiography Polymerase chain reaction and site directed mutagenesis Amplifi cation of the respective template DNAs with appropriate primers was performed with pfu DNA polymerase Strategene under the standard bu er conditions with 2 mM MgCl 2 The PCR conditions were 35 cycles of 94 C176C for 45 s 50 58 C176C for 45 s and 72 C176C for 45 s to 2 min The annealing temperature and extension time were subjected to adjustments according to the melting temperatures of the primers used and the lengths of the PCR fragments synthesized Site directed mutagenesis was carried out with two rounds of PCR and two pairs of primers Construction of plasmids Plasmids pET24 E pET24 3a pET24 3b pET24 6 pET24 7a and pET24 HCVE1 were constructed by cloning an NdeI XhoI digested PCR fragment into NdeI XhoI digested pET24a vector All the constructs have a His tag fused to the 3 0 end of the genes The two primers for SARS E protein are 5 0 CGGGATA TCCCATATGTACTCATTCGTTTCGGAA 3 0 and 5 0 CGGAATT CTTACTCGAGGACCAGAAGATCAGGAACTCC 3 0 The two primers for SARS 3a protein are 5 0 CGGGATATCCCATATGGA TTTGTTTATGAGATTT 3 0 and 5 0 CGGAATTCTTACTCGAGC AAAGGC ACGCTAGTAGTTCGT 3 0 The two primers for SARS 3b protein are 5 0 CGGGATATCCCATATGATGCCAACTACTT TGTTT 3 0 and 5 0 CGGAATTCTTACTCGAGACGTACCTGTTTC TTCCGAA A 3 0 The two primers for SARS 6 protein are 5 0 CGGGATATCCCATATGTTTCATCTTGTTGACTTC 3 0 and 5 0 CGGAATTCTTACTCGAGTGGATAATCTAACTCCATAGG 3 0 The two primers for SARS 7a protein are 5 0 CGGGATATCCCAT ATGAAAATTATTCTCTTCCTG 3 0 and 5 0 CGGAATTCTTACT CGAGTTCTGTCTTTCTCTTAATGGT 3 0 The two primers for HCV E1 protein are 5 0 CGGGATATCCCATATGTACCAAGTGC GCAATTCCTCG 3 0 and 5 0 CCGGAATTCTTAGCGGCCGCCGC GTCGACGCCGGCAAATAG 3 0 However the antibody fails to react with the 3b pro tein Fig 1B lane 9 The reason for the failure to de tect the His tagged 3b protein is currently uncertain ria This protein was excluded in the subsequent stud ies It was also noted that induction of the empty vector pET24a a ects the growth of bacteria carrying the plasmid compared with bacteria carrying pET24 3a and pET24 3b Fig 1A This may reflect the fact that overexpression of the multiple cloning site His Fig 1 A E ects of expression of SARS CoV proteins on bacterial growth E coli strain BL21 DE3 cells carrying pET24a E pET24a 3a pET24a 3b pET24a 6 pET24a 7a pET24a HCVE1 and pET24a were induced with 1 mM IPTG The cell densities were measured at 600 nm at indicated times post induction Cells carrying pET24a HCVE1 were used as positive control and cells carrying pET24a were used as negative control B Analysis of the expression of SARS CoV proteins Bacterial cells carrying plasmid pET24a E pET24a 3a pET24a 3b pET24a 6 pET24a 7a and pET24a HCVE1 were induced with 1 mM IPTG To detect the protein expression directly 150 lg ml of rifampicin was added 30 min post induction After incubation for 2 h cells were labeled with 35 S methionine for 15 min Electrophoresis of cell extracts was carried out in SDS 15 polyacrylamide gels lanes 1 6 The expression of these proteins from unlabeled bacterial cells harvested at 2 h post induction was analyzed by Western blotting using anti His monoclonal antibody lanes 7 12 Numbers on the left indicate molecular masses in kiloDaltons 376 Y Liao et al Biochemical and Biophysical Research Communications 325 2004 374 380 Once again no obvious band corresponding to protein 6 was detected Fig 1B lane 10 indicating the expres sion of this protein at a very low level in the bacterial cells As significant inhibition of the growth of bacte rial cells carrying this gene was observed Fig 1A it Plasmid pFlagE was constructed by cloning an EcoRV and EcoRI digested PCR fragment into EcoRV and EcoRI digested pFlag The Flag tag is fused to the N terminal end of the E protein The two primers used are 5 0 CGGGATATCCCATATGTATCA TTCGTTTCGGAA 3 0 and 5 0 CGGAATTCTTACTCGAGGACC AGAAGATCAGGAACTCC 3 0 Results and discussion Retardation of bacterial growth by SARS CoV E 6 and 7a proteins The e ect of overexpression of several SARS CoV proteins containing potential transmembrane domain on bacterial growth was initially tested For this pur pose nucleotide sequences covering the SARS CoV E 3a 3b 6 and 7a proteins and HCV E1 protein respectively were cloned into pET24a vector and were expressed in E coli BL21 DE3 a strain carry ing integrated in the chromosome the T7 RNA poly merase gene under the control of a lac UV5 promoter that can be induced by IPTG HCV E1 pro tein was chosen as a positive control as it has been shown to be able to increase membrane permeability when overexpressed in E coli cells 5 As shown in Fig 1A expression of 3a and 3b proteins rendered no obvious e ects on the growth of bacteria com pared with bacterial cells carrying the empty plasmid pET24a Certain degrees of retardation of bacterial growth were observed in cells expressing the E 6 and 7a and HCV E1 proteins Fig 1A The expression of these proteins was then checked by labeling bacterial proteins with 35 S methionine in the presence of rifampicin Fig 1B shows the presence of protein bands with apparent molecular masses of 9 3 lane 1 32 lane 2 18 5 lane 3 14 8 lane 5 and 21 7 kDa lane 6 corresponding to the expected His tagged E 3a 3b and 7a and HCV E1 proteins respectively However no band corresponding to the His tagged protein 6 8 5 kDa was detected Fig 1B lane 4 To confirm the expression and identities of these proteins Western blot analysis was conducted using anti His antibody The 9 3 kDa E protein lane 7 32 kDa 3a protein lane 8 14 8 kDa 7a protein lane 11 and 21 7 kDa HCV E1 protein lane 12 were detected confirming the expression of these proteins suggests that the protein may be highly toxic to bacte tag region in pET24a might a ect bacterial growth Modification of membrane permeability by the expression of E protein To test if the observed inhibition of bacterial growth by the expression of E and 7a proteins is caused by the modification of membrane permeability HB an antibi otic which can inhibit host cell protein synthesis but is normally impermeable to cells within a short period of time was added to the culture medium after induction of protein expression with IPTG When the cell mem brane permeability is altered it can translocate into cells to block cellular protein translation Cells were metabolically labeled with 35 S methionine for 15 min after addition of HB Expression of SARS CoV E pro tein allows the entry of HB to cells as host protein synthesis was completely blocked Fig 2A lanes 1 and 2 Similar inhibitory e ect on host protein synthe sis was observed in bacterial cells expressing the posi tive control protein HCV E1 protein Fig 2A lanes 5 and 6 No obvious e ect on membrane permeability was observed in cells expressing 7a protein Fig 2A lanes 3 and 4 To further confirm the observation that expression of tein caused a clear increase in the entry of ONPG into cells These results confirm that expression of SARS CoV E protein could increase membrane permeability in bacterial cells Oligomerization of E protein We next tested if E protein could form oligomers by analysis of the E protein expressed in bacteria and mam malian cells on both reducing and non reducing SDS PAGE gels After induction with IPTG the bacterial cells were harvested and lysed with the protein loading bu er plus 10 mM of iodoacetamide to irreversibly block the free cysteinyl thiols to form disulfide bonds Under such conditions electrophoresis of the bacterially expressed E protein on reducing SDS PAGE gel showed the detection of a 9 3 kDa band representing the mono mer of the E protein Fig 3 lane 2 In addition to the 9 3 kDa protein band analysis of the same sample on non reducing SDS PAGE gel showed the detection of a protein band migrating at the position of 27 kDa Fig 3 lane 1 representing a putative homotrimer of the E protein A At extracts determined Y Liao et al Biochemical and Biophysical Research Communications 325 2004 374 380 377 SARS CoV E protein can induce changes in membrane permeability entry of ONPG into bacterial cells was analyzed ONPG a substrate of b galactosidase is nor mally excluded by the membrane of intact cells Entry of ONPG into bacterial cells was easily monitored by mea suring its conversion to a colored compound by the b galactosidase activity present in bacterial cells As shown in Fig 2B induction of the expression of E pro Fig 2 Modification of membrane permeability by SARS CoV E protein pET24 E pET24 7a and pET24 HCVE1 were induced with 1 mM IPTG proteins were metabolically labeled with 35 S methionine for 15 min Cell were used as positive control Numbers on the left indicate molecular masses cells carrying pET24 E pET24 7a pET24 HCVE1 and pET24a were induced times and incubated at 30 C176C for 10 min The b galactosidase activity was HCVE1 were used as positive control and cells carrying pET24a were used The E protein was then expressed in HeLa cells To detect the protein expression an 11 amino acid Flag tag was fused to the N terminus of the E protein Anal ysis of the E protein expressed in HeLa cell on reducing SDS PAGE gel showed the detection of the 9 3 kDa monomer Fig 3 lane 4 Both the 9 3 kDa monomer and the 27 kDa trimer were observed under non reduc ing conditions Fig 3 lane 3 Entry of HB into bacterial cells BL21 DE3 cells transformed with 1 h post induction 2 mM HB was added After incubation for 15 min were analyzed by SDS 15 PAGE Cells carrying pET24 HCVE1 in kiloDaltons B Entry of ONPG into bacterial cells BL21 DE3 with 1 mM IPTG Two millimolar ONPG was added at the indicated by measuring the absorbance at 420 nm Cells carrying pET24 as negative control Fig 4 Mutational analysis of the role of three cysteine residues of E protein in its modification of membrane permeability and oligomer ization A Entry of HB into bacterial cells expressing wild type and mutant E proteins BL21 DE3 cells transformed with pET24 E pET24 M1 pET24 M2 pET24 M3 pET24 M4 and pET24 M5 were induced with 1 mM IPTG At 1 h post induction 2 mM HB was added After incubation for 15 min proteins were metabolically labeled with 35 S methionine for 15 min Cell extracts were analyzed by SDS 15 polyacrylamide gel Numbers on the left indicate molecular mass in kiloDaltons B Oligomerization of wild type and mutant E protein The His tagged wild type and mutant E proteins expressed in BL21 DE3 were separated on SDS 15 polyacrylamide gels under non reducing conditions Polypeptides were transferred to PVDF membrane and probed with anti His monoclonal antibody After incubation with horseradish peroxidase conjugated anti mouse IgG the E protein was detected by a chemiluminescence detection kit Numbers on the left indicate molecular masses in kiloDaltons 378 Y Liao et al Biochemical and Biophysical Research Communications 325 2004 374 380 Occasionally a protein band migrating between the 9 3 kDa monomer and the 27 kDa trimer could be de tected when the E protein expressed in both bacterial and mammalian cells was analyzed under non reducing conditions Fig 3 lanes 1 and 3 and see Fig 4B It may represent dimerization of the E protein These re sults suggest that the E protein may form homo dimers and trimers in both bacterial and mammalian cells The essential roles of two cysteine residues of E protein in its modification of membrane permeability and oligomerization in E coli cells Examination of the amino acid sequence of E protein showed that the protein contains three cysteine resi